Expert answer:need help again ! 2 questions ..just discussion qu

Uncategorized

Solved by verified expert:QUESTION #1 (CAN I GET THIS TODAY BEFORE MIDNIGHT) ANSWER DOESN’T HAVE TO BE LONG.Genetic mutation is what leads to the mechanism of natural selection, and thus contributes directly to evolution, a necessary and useful process. The crossing over and randomization at fertilization also increases variation. Without the variation that results from mutations, natural selection would not occur, thus proving that genetic mutations are beneficial and crucial for life. However, cancer is a disease caused by mutation. Does this mean that cancer is inescapable for all humans if we simply live long enough?QUESTION #2 (I DONT NEED THIS ONE UNTIL TOMORROW).Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence:AGTAAACGTACCTGAGACGGGExplain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.

How it works

Paste your instructions in the instructions box. You can also attach an instructions file
Select the writer category, deadline, education level and review the instructions
Make a payment for the order to be assignment to a writer
Download the paper after the writer uploads it

Will the writer plagiarize my essay?

You will get a plagiarism-free paper and you can get an originality report upon request.

Is this service safe?

All the personal information is confidential and we have 100% safe payment methods. We also guarantee good grades

Continue to order Get a quote

Place your order

Type of paper

Academic level

Deadline

Pages (550 words)

Approximate price: $22

Our guarantees

Delivering a high-quality product at a reasonable price is not enough anymore.
That’s why we have developed 5 beneficial guarantees that will make your experience with our service enjoyable, easy, and safe.

Money-back guarantee

You have to be 100% sure of the quality of your product to give a money-back guarantee. This describes us perfectly. Make sure that this guarantee is totally transparent.

Zero-plagiarism guarantee

Each paper is composed from scratch, according to your instructions. It is then checked by our plagiarism-detection software. There is no gap where plagiarism could squeeze in.

Free-revision policy

Thanks to our free revisions, there is no way for you to be unsatisfied. We will work on your paper until you are completely happy with the result.

Privacy policy

Your email is safe, as we store it according to international data protection rules. Your bank details are secure, as we use only reliable payment systems.

Fair-cooperation guarantee

By sending us your money, you buy the service we provide. Check out our terms and conditions if you prefer business talks to be laid out in official language.