Expert answer:explained in attached file

Solved by verified expert:this file includes a tutorial and the homework problems, the problems start from page 6
f_17_bme_6762_assignment_b.docx

Unformatted Attachment Preview

1
TUTORIAL SET I
MUTATION
Mutational implications on the residues in biosequences: Mutations can be classified several
different ways. This tutorial will focus on sorting such mutations by their effect on the structure
of DNA or a chromosome. For this categorization, mutations can be separated into two main
groups, each with multiple specific types. The two general categories
are large-scale and small-scale mutations.
Small-scale mutations: These are those that effect the DNA at the molecular level by changing
the
normal sequence of nucleotide base pairs. These types of mutations may occur during the
process of DNA replication during either meiosis or mitosis. There are three possible small-scale
mutations that may occur: Substitution, deletion and insertion as described below. The
occurrence of substitutions, deletions and insertions is in general due to mutations. A mutation
refers to an epoch wherein a DNA gene is damaged or changed (in such a way as to alter the
genetic message carried by that gene). Relevant permanent alteration to the physical composition
of a DNA gene (such that the genetic message being changed) is caused by an agent of substance
called mutagen.
Large-scale mutations: These mutations effect entire portions of the chromosome. Some largescale mutations effect only single chromosomes, others occur across nonhomologous pairs.
Some large-scale mutations in the chromosome are analogous to the small-scale mutations in
DNA; the difference is that for large-scale mutations entire genes or sets of genes are altered
rather that only a single nucleotide of the DNA. Single chromosome mutations are most likely to
occur by some error in the DNA replication stage of cell growth, and therefore could occur
during meiosis or mitosis. Mutation involving multiple chromosomes is more likely to occur in
meiosis during the crossing-over that occurs during the prophase I. Large scale mutations are
deletion, duplication, inversion, insertion, translocation and non-disjunction types as will be
explained later.
Mutation and derivatives: Mutation results in a change in DNA, usually in its sequence, the
number of copies of a sequence that are present, how the DNA is arranged, or its location,
(namely, at which chromosome). Use one or more of the following methods for mutating the
design and build both – the resulting single strand and “duplex” relevant to a query sequence.
Small-scale mutation – definition:
(A)
Point mutation: Substitute an individual base with another. It is a type of mutation that
causes a single nucleotide base substitution, insertion, or deletion of the genetic material, DNA
or RNA. Some common substitutions: A for C; A for G; C for T; G for T, A for T; G for C. A
point mutant is an individual that is affected by a point mutation.
Page 1 of 39
2
Illustration of three types of point mutations to a codon.
Schematic of a single-stranded RNA molecule illustrating a series of three-base codons.Each
three-nucleotide codon corresponds to an amino acid when translated to protein.When one of
these codons is changed by a point mutation, the corresponding amino acid of the protein is
changed.
A point mutation, or single base modification, is a type of mutation that causes a change in a
single nucleotide base via substitution, insertion, or deletion of the genetic material, DNA or
RNA.
Substitution: A substitution is a mutation that exchanges one base for another (i.e., a change in a
single “chemical letter” such as switching an A to a G). Such a substitution could, (i) change a
codon to one that encodes a different amino acid and cause a small change in the protein
produced. For example, sickle cell anemia is caused by a substitution in the beta-hemoglobin
gene, which alters a single amino acid in the protein produced; (ii) change a codon to one that
encodes the same amino acid and causes no change in the protein produced. These are called
silent mutations and (iii) change an amino-acid-coding codon to a single “stop” codon and cause
an incomplete protein. This can have serious effects since the incomplete protein probably may
not be functionally useful.
Insertion: These are mutations in which extra base pairs are inserted into a new place in the
DNA.
Page 2 of 39
3
Deletion: These mutations are those in which a section of DNA is lost, or deleted – that is,
deleting a segment of a sequence.
Frameshift: The term frameshift mutation indicates the addition or deletion of a base pair. Since
protein-coding DNA is divided into trinucleotides, insertions and deletions can alter a gene so
that its message is no longer correctly parsed. Such changes are called frameshifts.
(For example, consider the sentence, “The fat cat sat.” Each word represents a codon. If
we delete the first letter and parse the sentence in the same way, it doesn’t make sense).
With frameshifts, a similar error occurs at the DNA level, causing the codons to be parsed
incorrectly. This usually generates truncated proteins like “hef atc ats at”, which are
uninformative.
Transposition: Move a segment of the sequence from one place to the other in the overall order.
Duplication: Repeat a section of the sequence one or more times
Repeat induced point (RIP) mutations: These are recurring point mutations. RIP is a genome
defense in fungi that hypermutates repetitive DNA. It is suggested that RIP limits the
accumulation of transposable elements [M. E. Hood, M. Katawczik and T. Giraud: Repeatinduced point mutation and the population structure of transposable elements in Microbotryum
violaceum. Genetics, 2005, vol. 170(3), 1081–1089].
Large-scale mutations – definitions
Deletion: Large-scale deletion is a single chromosome mutation. This involves the loss of
one or more genes from the parent chromosome.
Duplication: Duplication is the addition of one or more genes that are already present in the
chromosome. This is a single chromosome mutation.
Inversion: It involves inverting a segment of the sequence, say, a complete reversal of one or
more genes within a chromosome. The genes are retained post-inversion, but its order is
backwards from the parent chromosome. This is also a single chromosome mutation. That is,
inversions refer to one type of genetic mutation that creates changes in a chromosome.
Insertion: Large-scale insertion involves multiple chromosomes. For this type of insertion,
one or more genes are removed from one chromosome and inserted into another
nonhomologous chromosome. This can occur by an error during the prophase-I of meiosis
when the chromosomes are swapping genes to increase diversity.
Translocation: Translocation also involves multiple nonhomologous chromosomes. Here
the chromosomes swap one or more genes with another chromosome.
Non-disjunction: A non-disjunction mutation does not involve any errors in DNA
replication or crossing-over. Instead these mutations occur during the anaphase and
telophase when the chromosomes are not separated properly into the new cells. Common
non-disjunctions are missing or extra chromosomes. When gametes with non-disjunctions are
produced during meiosis, it can result in an offspring with a monosomy or trisomy (referring
to a missing or extra homologous chromosome).
Effects of mutations
The effects of mutations may range from nothing all the way to unviability of a cell. All
mutations will affect the proteins created during protein synthesis; but not all mutations will have
a significant impact on the final product. Such effects can also be distinct between the smallscale and large-scale mutations.
Page 3 of 39
4
Conservative substitution: This refers to a nucleotide mutation, which alters the amino acid
sequence of the protein, causing substitution of one amino acid with another, which has a side
chain with similar charge/polarity characteristics. The size of the side chain may also be an
important consideration. Conservative mutations are generally considered unlikely to profoundly
alter the structure or function of a protein, but there are many exceptions
Non-conservative substitution: This corresponds to a mutation, which results in the substitution
of one amino acid within a polypeptide chain with an amino acid belonging to a different
physico-chemical property such as, polarity/charge group.
Convergent and parallel substitutions: In comparisons among orthologous proteins from a
given set of species, convergent substitutions at a particular site refer to independent changes
from different ancestral amino acids to the same derived amino acid. In the illustration (a) below,
there is a change from G (the ancestral state) to T (the derived state) in one species, and a change
from A to T in another species. The convergent substitutions are denoted by red bold lines.
Parallel substitutions at a site refer to independent changes from the same ancestral amino acid
to the same derived amino acid. In the case of illustration (b), changes from A to T occurred in
two different species. The parallel substitutions are denoted by red bold lines.
In sets of closely related species, parallelism is generally more common than
convergence simply because – at any given site – close relatives will be more likely to share the
same ancestral state prior to the occurrence of independent substitutions [J. F. Storz: Causes of
molecular convergence and parallelism in protein evolution. Nature Reviews Genetics, 2016,
vol.17, 239-250]
Coincidental substitutions: The occurrence of two substitutions at the same nucleotide site in
two homologous sequences.
——————————————————————————————————————–Example A: Assume a hypothetical initial strand
… AAAAGGGGTTTTGACC … and
perform an insertion version of mutation with a sub-sequence inserted at an arbitrary location.
Solution
For the assumed strand, the insertion version of mutation say, for example with a sub-sequence
‘CCCC’ at an arbitrary location, will result in the following:
… AAAAGGCCCCGGTTTTGACC …
Page 4 of 39
5
———————————————————————————–Example B: Suppose one
or more ancestral sequences are given. Assuming different types of mutational changes occur as
indicated, evaluate the outcomes
Presumed mutational
change type
No change:
Retained as it is
Single substitution
CA
Multiple sequential
Substitutions
GAT
Back substitution
CTC
Coincidental
substitutions: With reference to
two homologous sequences,
two substitutions at the same
nucleotide site
TG
Parallel
substitutions
at a site: This refer to
independent changes from the
same ancestral amino acid to
the same derived amino acid.
T  C or G
Convergent
substitutions:
Independent changes from
different ancestral amino acids
to the same derived amino
acid.
Result on the sequence(s)
… A C C C T A C G …
…ACCCTACG…
…ACCCTACG…
… A A A A T A A G…
… A A A A T A A G… 
… A A A A T A A C… 
… A A A A T A A T…
… A A A A T A A C… 
… A A A A T A A T… 
… A A A A T A A C…
Homolog sequence: Y1
… A A A T A A T…
Homolog sequence: Y2
… C A A T A A T…
Coincidental substitutions are
shown bold:
Y1* … A A A G A A T…
Y2* … C A A G A A T…
Given homolog species Z:
Z: … G A A A C A A T…
Parallel mutations are shown bold :
Z1*:  … G A A A C A A C…
Z2*:  … G A A A C A A G…
Say two different ancestral AAs, Z1
and Z2 are considered:
Z1: … A A T G A T
Z2 : … A A T
Independent changes from different
ancestral amino acids to the same
derived residue, T
———————————————————————————–
Page 5 of 39
6
Problems on mutational changes
Problem B.1
Construct a matrix of the set {A, C, T, G} to illustrate the characteristic of the transition and
transversion mutations.
(Hint: You may use a score of 100 % to depict the element of the matrix pertinent to no
mutation – for example for 100% for A-to-A as shown; and, use prorated percentages to
represent other elements illustrating the characteristic as above. The spontaneous base
substitutions ratio of transitions to transversions is approximately 2:1. Therefore each transition
should have a probability of 2/3 and each transversion 1/3).
Answer:
A
A
C
T
G
100%
C
T
G
———————————————————————————————————————Problem # B.2 (a)
A strand is presumably mutated at a location underlined in the sequences shown below. In each
case, (i) write down the eventual resulting strand for the following additional mutations
happening in succession:
1) Inversion of some subsequence part
2) Deletion of some subsequence part
3) Transpose of some subsequence part
4) Duplication of a base-pair in the sequence
5) Point mutation of one base into another
(Hint: The answers may depend on subjective selection as required)
a)
…..TTAAGGGGGGCCTTTTGAAA….
Example answer: (5) GGGG → GGCG
(b)
….,,AAAAGGGGGGCCTTGGGACC….
(c)
……CCAAGGGTGTCCTTTTGAGG….
(ii) In each case, also write down the corresponding final resulting duplex strands at preRNA
level
1. GGCG
Example answer: CCGC
2. AAATAA
3. TCCT
Page 6 of 39
7
4. CGTTA
——————————————————————————————————————-Problem B. 2(b)
Consider an ancestral sequence:
…ACCCTAC …
Suppose a sequence of changes occur on this segment as follows: Single substitution, no change,
multiple substitutions, back substitution, parallel substitutions, coincidental substitutions and
convergent substitutions.
Write down two possible resulting sequences.
1) Initial ACCCTAC
Single Sub (A→G)CCCTAC (Example answer)
No Change Multiple Sub Back Sub Parallel Sub Coincidental SubConvergent Sub 2) Initial ACCCTAC
Single Sub No Change Multiple Sub A(C→T→A)CCTTC (Example answer)
Back Sub Parallel Sub Coincidental SubConvergent Sub ——————————————————————————————————————–Problem B.3
Given a sequence:
X:
5’ – TAC GGA TCG AAT GCT CCC GTA ATC – 3’
Suppose the following mutations have occurred in succession: A single point mutation, deletion
of a triplet and duplication of a triplet twice in succession; and, the resulting complementary
strand is found to be:
Y:
3’ – ATG CCT AAC TTA CGG CAT CAT CAT TAG – 5’
Find
Single Point Mutation – (Example answer: Highlight in YELLOW. In triplet 3, the
second base C was changed to T. …. GGA TCG …. to …. CCT AAC ….)
Deletion of a Triplet – Highlight in RED.
Duplication of a Triplet – Highlight in GREEN.
Page 7 of 39
8
Trace/identify all the mutational changes occurred from X to Y.
——————————————————————————————————————–
SEQUENCE ALIGNMENT & SCORING: TUTORIAL
EXERCISES: Problems on sequence alignment and scoring
The following notations are used for the alignment status for a given pair:
Notations used to denote the alignment status between a pair of sequences
(i)
Vertical bar
Identical residues
(ii)
One dot
Somewhat similar residues
(iii) Two dots
Very similar residues
EXAMPLE
x:
AAGCTTACGCAAACCG
| · | : || · | ·· ·:
y: GCTCACGGTTGCCACT
Problem B.4
(i)
Apply the above notations for the alignment status for the given pair:
….L F D E L N R V V……….
| | | : : | . | .
….L F D D I N Q V L ……..
(ii)
Denoting “s” for transition mutation and “v” for transversion mutation, determine
the sites at which s or v have occurred in the following test pair (a, b):
Example: Black brackets and V denote transversions, while Green S denotes transition
x: Q [Q D] [I L] F ….
S
S
y: Q [D Q] [L V] V ….
V
V
Test pair:
a: F Q D I L F R R D D I I I F Q L
b: F D Q L V V R E N D D D N Q F I
V
V
V
V
Find transitions in y after all transversions have occurred.
V→I, V→F, E→R, D→I, N→I, N→L.
——————————————————————————————————————–Problems on basic pairwise alignment procedure
Page 8 of 39
9
Example: Consider the following two short nucleotide sequences, each of seven residues only.
Construct two possible alignments allowing two gaps. (A gap is defined as any maximal
consecutive run of spaces in a single string of a given alignment. They facilitate creating
alignments that better conform to underlying biological models and more closely and
appropriately fit patterns vis-à-vis a meaningful alignment expected).
X: T A C C A G T
Y: C C C G T A A
Solution(s) :
(i)
X: T A C C A G T  
Y: C  C C  G T A A
(ii)
X: T A C C A G T  
Y:   C C C G T A A
Problem B.5
Consider the following two short nucleotide sequences, each of 10 residues only. Construct two
possible alignments allowing three gaps. (A gap is defined as any maximal consecutive run of
spaces in a single string of a given alignment. They facilitate creating alignments that better
conform to underlying biological models and more closely and appropriately fit patterns vis-à-vis
a meaningful alignment expected).
X: A A C C A G T A AT
Y: T C C C T A A G T T
——————————————————————————————————————–Problems on scoring the alignments
Example
Consider the following alignment:
S 😡
T:
ATCG GATGGAC
ACGGAAT  CC
This alignment has four gaps containing a total of six spaces (). Further, it can be described as
having five matches and two mismatches
Problem B.6
Consider the following two pairs of aligned nucleotide sequences (X, Y) and (U, V).
(i)
Describe the alignments in each pair in terms of the counts on existing matches,
mismatches, gaps and spaces
(ii)
Apply the following award/penalty scoring scheme and compare the alignment
(X, Y) versus (U, V) in terms of the overall scores obtained in each case
Page 9 of 39
10
Scoring scheme: Match: say, 100; Mismatch: (Purine  Purine or Pyrimidine  Pyrimidine) –
Transition, say:75; (Purine  Pyrimidine or Purine  Pyrimidine)- Transversion: say 10;
Space: − 50.
X:
A GCC ATATA
Y:
A G G AC A A  T T A
U:
V:
AGCCATATA
AGCAATTA
Example answer for X, Y: This alignment has two gaps with three total spaces. It also has 5
matches and three mismatches. The score for this alignment would be (5 ×100) + (75 ×1) + (10
× 2) − (50 × 3) = 445
Deduce the score for: U : V
(550)
——————————————————————————————————————–Problems on: Sequence similarity and notion of “distance”
Given two character strings, the measures of “distance” between them are: (i) Statistical
distances (in Euclidian sense) such as, Mahalanobis distance and its variations. (ii) Hamming
distance and (iii) Levenshtein distance (edit distance)
Hamming distance
The Hamming distance between two strings of equal length is the number of positions at which
the corresponding symbols are different. That is, it measures the minimum number of
substitutions required to change one string into the other, or the minimum number of errors that
could have transformed one string into the other.
Examples
AGTC
CGTA
Hamming distance (HD) = 2
KENTUCKY
TENTURKI
Hamming Distance = 3 (K/T, C/R, Y/I)
Edit distance
This refers to the edit distance (also known as Levenshtein distance) between two sequences
expressed in terms of minimal number of operations (indels and substitutions) exercised to
transform one sequence to another. This edit distance approximately specifies the number of
DNA replications taken place across two sequences. That is, the Levenshtein distance (LD) is a
string metric for measuring the difference between two sequences. Simply, the LD between two
words is the minimum number of single-character edits (i.e. insertions, deletions or substitutions)
require …
Purchase answer to see full
attachment

How it works

1. Paste your instructions in the instructions box. You can also attach an instructions file
2. Select the writer category, deadline, education level and review the instructions 
3. Make a payment for the order to be assignment to a writer
4.  Download the paper after the writer uploads it 

Will the writer plagiarize my essay?

You will get a plagiarism-free paper and you can get an originality report upon request.

Is this service safe?

All the personal information is confidential and we have 100% safe payment methods. We also guarantee good grades